logo
 
Annual Report
(2015-2016)
English
Newsletter
April to September, Vol. 19 No. 1, 2016
RTI
Vision 2030
Vision 2030
Holidays
<<

June, 2017

>>
  • S
  • M
  • T
  • W
  • Th
  • F
  • Sa
  •  
  •  
  •  
  •  
  • 01
  • 02
  • 03
  • 04
  • 05
  • 06
  • 07
  • 08
  • 09
  • 10
  • 11
  • 12
  • 13
  • 14
  • 15
  • 16
  • 17
  • 18
  • 19
  • 20
  • 21
  • 22
  • 23
  • 24
  • 25
  • 26
  • 27
  • 28
  • 29
  • 30
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image41
  • image64
  • Current
Research Achievements
1. Resource Assessment and Management
The country has significant coldwater aquatic resources in terms of upland rivers, streams, high and low altitudinal natural lakes, reservoirs that hold large population of indigenous and exotic, cultivable and non-cultivable fish species. Information on resources is obsolete and updating information is a challenge due to its kaleidoscopic topography of the sector. The fishery resources of Indian Himalayan region have been digitized.
Fishery Resources of Indian Himalayan region
Suitable sites for aquaculture can be located based on water quality, soil quality and infrastructure facilities as road connectivity, availability of seed and etc. The weightage of the criteria were analyzed through Analytical Hierarchical Process (AHP). Resource inventory is one of the significant applications of geoinformatics in fisheries management for need based planning.
Fishery resource Map of Sikkim and Jammu & Kashmir
2. Aquaculture
Polyculture of exotic carp in polylined tanks at mid-altitudinal regions (800-2000m MSL)
Earthen ponds lined with polythene sheets (LDPE) have been found suitable for fish culture in mid-altitudinal hill areas. These tanks are also used for rainwater harvesting in uplands areas where scarcity of water becomes major bottleneck in agricultural production. The use of polylined pond/tanks are advantageous for increasing fish production as water temperature during winter remains comparatively higher and support sustenance of natural food for growing fish.
Induced breeding and seed production of Indigenous minor carp (Labeo dyocheilus and Labeo dero
Labeo dyocheilus (McClelland) and Labeo dero (Hamilton, 1822) are important indigenous cold water fish species, endemic to the Himalayas and inhabiting upland streams and rivers at an elevation of 400-800M. Breeding and seed production technology for both the species has been developed by DCFR, Bhimtal. Water temperature ranging 18-220C found suitable for the spawning and egg incubation in coldwater condition. Successful breeding technique in captive condition enabled seed production for wild stock augmentation and species diversification in coldwater aquaculture.
First Report: Successful breeding of Chagunius chagunio and Barilius bendelisis
Chagunius chagunio, belongs to family cyprinidae commonly known as "Chaguni" is one of the economically important indigenous fish having its distribution in Brahmaputra and Ganga drainages along the Himalayan foot hills. In Kumaon Himalayan region, C. chagunio is locally called as "Chippan" has high consumer preference and fetch very good market price of about Rs. 300/kg. Captive reared brood stock of this minor carp was successfully bred under coldwater conditions and breeding protocol was developed for the seed production.
   
The hill trout cyprinid, Barilius bendelisis (Hamilton), has recently drawn the attention as one of the potential candidate species for aquaculture. It is commonly distributed in Brahmaputra and Ganga drainages along the Himalayan foot hills. As per IUCN red list (2012) this fish has been categorized as least concern but in future the major threat to this species is over exploitation, habitat destruction due to natural and human interruption. Therefore, in order to overcome this problem, breeding and propagation of B. bendelisis is a prerequisite task to replace the stock. Barilius bendelisis being a demanding ornamental as well as potential food fish has not received any research attention for breeding and seed production and fish has been successfully bred for first time.
Captive breeding of Labeo pungusia  
Labeo pungusia is threatened species as per IUCN but having good potential for food fish in North-Eastern India. To conserve and rehabilitate the species, successful breeding achieved at Eco-camp, ABACA, Nameri, Assam for conservation and species diversification of aquaculture in North East hill region.
  Mature specimen of Labeo pangusia
Pond culture of Bangana devdevi  
Bangana devdevi is potential species of Manipur, locally known as  Khabak. Hence, ICAR-DCFR with Krishi Vigyan Kendra, Thoubal, Manipur have undertaken initiative to culture this fish in farmers pond.
Rearing of fingerlings of Himalayan Golden Mahseer (Tor putitora) in floating cages
Open water bodies in hills provides opportunities for in situ seed rearing in floating cages which may be used for the stock enhancement programmes. Protocol for in situ rearing density of golden mahseer upto advanced fingerling stage have been developed with appropriate stocking density and feeding practices.
Promotion of rainbow trout (Oncorhynchus mykiss) farming in Sikkim
The Directorate has provided technical support to state for promotion of trout culture. State has achieved total production of rainbow trout around 110 tonnes from both public sector and in private sector having 220 private trout raceways in the state. Most of the production is consumed locally in households and in some high class hotels. Trout farming is a viable livelihood option for the local population with high market demand in the higher altitudinal areas. A constant technical support has been provided by the DCFR, Bhimtal for infrastructural development, brood stock maintenance and seed production, feed formulation including advisory service and hands on training to the trout growers. Healthy brood stock of Rainbow trout has been maintained at State trout farm, Uttarey and produced 1.5 lakh advanced fingerlings and 3 lakh eyed ova of Rainbow trout during this breeding season. A wooden stripping stand was designed by DCFR for easy stripping operation and to reduce the man power, physical stress on brooder and on breeder during stripping operation. The device was practically demonstrated to the farmers.
DCFR rehabilitated natural disaster affected 6 tribal farmer's families at Upper Rimbi, West Sikkim and provided financial & technical support for raceway renovation, trout seed stocking and trout feed. Seed of Rainbow trout was stocked in those renovated raceways during the month of May, 2014 and achieved good growth with best management practices. Technical advice was provided to the trout growers for maintaining sufficient water flow, appropriate design of outlet, optimum stocking density and feeding management. Individual selection of the brood stock was carried at Uttarey for the stock improvement with the target of 5 lakh eyed ova production in the next breeding season
Promotion of trout culture in Highlands of Leh & Ladakh
Leh- a tribal district has low opportunity of agriculture due to harsh climatic conditions while trout culture can be adopted as small scale enterprises which can provide round the year livelihood support to the dwellers. ICAR-Directorate of Coldwater Fisheries Research, Bhimtal has initiated trout faming programme under Tribal Sub Plan for improving socio-economic status of the tribal population during 2013-14 in collaboration with HMAARI (SKUAST-K) RRS- CAZRI (ICAR)-Leh and Department of Fisheries, Govt. of Jammu & Kashmir. Initially three (3) existed raceways were repaired and 5 new raceways were got constructed in Chushout Shamma village which is about 20 km from the Leh and located near the bank of a tributary of River Indus at 3280 meter above sea level. Presently, six (6) tribal families are covered under trout farming programme and a total of 13 trout raceways have been created. Technical know-how and inputs (trout seed and feed) provided to the farmers.
Trout seed and feed distribution
   
A View of trout raceways Creating awareness in Kisan Mela
3. Fish Nutrition and Feed Development
Protocols for the successful culture of Chlorella and rotifer for feeding of mahseer larvae were developed.
The protocol for preparation of microparticulate diet for golden mahseer larvae has been established and based on this protocol, a microparticulate diet "NANHE MAHSEER" for feeding of golden mahseer, Tor putitora larvae has been developed and evaluated.
Cost effective growout feed with 1.43 FCR has been developed and evaluated for culture of chocolate mahseer, Neolissocheilus hexagonolepis.
Cost effective and efficient starter and growout feed with an FCR of 1.26 has been developed and field tested for rearing of rainbow trout.
4. Fish Health Management
Pathogenic bacteria profile of rainbow trout farms, Champawat (Uttarakhand), Dachigaon, Kokernag (Jammu & Kashmir), Kullu & Jogindernagar (Himachal Pradesh) is developed
Bacteria in group Aeromonand [Aeromonas hydrophila RTK08 (KC603616), RTMCX1 (JX390650), RTG33 (KC603615), Aeromonas allosaccharophila RTGT19 (KC603617), RTKKO1 (KC816585), Aeromonas veronii (A.  ichthiosmia) RTCE02 (KC582608), RTGBCX2 (JX390651), RTGBCX2 JX390651.1, Aeromonas sobria RTSKO3 (KC816586), Aeromonas popoffii RTGL26 (KC603614)] frequently isolated from tissue samples of rainbow trout, Oncorhynchus mykiss are considered as predominant, opportunistic pathogen in trout farms.
Fourstrains of Lactococcus garvieae (GenBank accession no: KM 604701, KM 604702, KM 604703 and KM 604704) are isolated & identified from diseased rainbow trout showing typical symptoms [unilateral exophthalmia, inflammation and swollen vent, petechial haemorrhages in viscera, focal haemorrhages and swelling in liver] of lactococcosis from Uttarakhand and Himachal Pradesh.    
Antibacterial susceptibility test of Enterococci isolated from diseased eye (corneal opacity) of rainbow trout from Jogindernagar, Himachal Pradeshshowed resistant to Nalidixic acid(Na30), Ketocomazole(Kt10), Clindamycin(Cd2), Lincomycin(L2), Cephalexin(Cp30), Polymyxin B(Pb50), Amphotericin B(AP100), Ceftazidine-Ca30/10, Cloxacillin Cx5, Metronidazole (MT5), Fluconazole (Fu10), Fluconazole (Fu25), Amphotericin B(AP20), Itraconazole(It10), Oxacillin (Ox5), Sulphamethoxypyridazine(St300), Methicillin (Met10) out of 36 tested market antibiotics. 
Green-yellow pigmented strain of Pseudomonas koreensis, TPEB02, (JX390644) is recovered from the golden mahseer eye, demonstrating opacification of the spectacle in conjugation with increased prominence of vessels.  
Pathogenecity of Pseudomonas koreensis, TPEB02, (JX390644) is established through experimental infection of 12hr cultures of P. koreensis to golden mahseer fingerlings.
Emerging fish pathogen, Chryseobacterium scophthalmum (KM822770) is isolated from golden mahseer gill in Bhimtal Lake showing clinical symptoms bacterial gill disease. Detail study of prevalence & patho-physiology of this pathogen is under investigation. 
Occurrence of corneal hypertrophy is observed in fingerlings of chocolate mahseer, Neolissochilus hexagonolepis (McClelland, 1839) from Uttarakhand, India.
Incidence of viral diseases of cold water fish species from the States of Jammu & Kashmir, Himachal Pradesh, Uttarakhand, Sikkim and Aruanchal Pradesh are being investigated under NSPAAD.
 
  • Documented aqua-drugs and medicines from Uttarakhand (45 farms), Himachal Pradesh (26 farms), Sikkim (68 farms), Tripura (62 farms), Meghalaya (65 farms) and Arunachal Pradesh (30 farms)
  • Salt, lime, KMnO4, cypermethrin-high cis (TIK-OUT), WASORICH (probiotics), Q4ALL (for broad spectrum biodegradable disease control), aqua promass and aquamin (as growth promoters), tetracycline hydrochloride, malachite green, betadine, CIFAX, bleaching powder, clinar, apiclin, vazra, domax are commonly applied in above coldwater states.
Figure 1a: Unilateral exophthalmia & b: Inflammation & swollen vent showing typical symptom of Lactococcosis, c: Golden mahseer (Tor putitora) eye, demonstrating opacification of the spectacle conjugation with increased prominence of vessels, d: Golden Mahseer (Tor putitora) showing symptoms of Bacterial Gill Disease (BGD) collected from subtropical Himalayan Lake Bhimtal, e:   Corneal hypertrophy observed in fingerlings of chocolate mahseer, Neolissochilus hexagonolepis (McClelland, 1839).
5. Coldwater Fish Molecular Genetics
Genomic Resources
1. Mitochondrial DNA sequences:
Table: Mitochondrial DNA sequences
Species Cyt b ATPase6/8 COI COII 16 SrRNA
Tor putitora 170 161 6 10
Tor khudree 4
Tor chelynoides 4
Neolissochilus hexagonolepis 5
Schizothorax richardsonii 47 25 22 25 10
Schizothorax progastus 5 5 5 5
Schizopyge niger 3 5 5 5
Schizothorax esocinus 4 5 5 5
Barilius bendelisis 15 6
Garra gotyla 8
Acanthocobitis  botia 2
Schistura obliquofascia 5
Schistura rupecula 7
Glossogobius gutum 6
Glossogobius giuris 4
Glossogobius spp.     6    
2. Complete Mitochondrial Genome Organization of Coldwater Fish Species
The complete mitochondrial genome of important coldwater fish species under genus Schizothorax (snow trout) and Tor (mahseer) was determined for the first time. This study will provide the rationale for the management and conservation of the endemic coldwater fish species.
Table: Details of complete mitochondrial genomes of different coldwater fish species

Species

Genome Size (bp)

GenBank
Accession number

Protein coding genes

tRNA

rRNA

A + T content

G + C content

Schizothorax richardsonii

16,592

KC790369

13

22

2

55.4%

44.6%

S. labiatus

16,582 

KF739398

13

22

2

55.3%

44.7%

S. progastus

16,575

KF739399

13

22

2

55.2%

44.8%

S. esocinus

16,583 

KF600713

13

22

2

55.2%

44.8%

S. plagiostomus

16,576 

KF928796

13

22

2

55.8%

44.2%

Schizopyge niger

16,585

NC_022866

13

22

2

55.2%

44.8%

Tor putitora

16,576

KC914620

13

22

2

56.9%

43.1%

Species Characterization
Mitochondrial Genome organization of S. richardsonii Mitochondrial Genome organization of Tor putitora
3. Development of Microsatellite Markers
Microsatellite markers in important coldwater fish species were developed. The informative loci can be used for population genetics studies and long-term endeavours such as genome mapping, localization of quantitative trait loci and the implementation of marker-assisted selection.
Table: Development of microsatellite marker from genomic library

Species

No. of Markers developed

GenBank
Accession number

Schizothorax richardsonii

51
26 (ESTs SSR)

HM591233-HM591283
JK087- 411, 471, 486, 532, 553, 716, 738, 740, 763, 886, 902, 903, 992, JK088032, 043, 048, 052, 064, 073, 103, 106, 195, 201, 219, 319, 390

Schizopyge niger

12

KC339275-KC339286)

Garra gotyla

52

HQ288484-HQ288526 & JF268657-JF268665

Tor putitora

22
34 (EST SSR)

JX270775-JX270794

Schistura sikmaiensis

36

KJ545923-KJ545958

Neolissocheilus hexagonolepis

12

validation in process

4. Development of EST Markers from cDNA of Schizothorax richardsonii
The snow trout (Schizothorax richardsonii) is an economically important fish in the north-east Himalayan region. However, genomic research on this species is still in its infancy, and genomic resources are largely unavailable. The objective of this study was to generate expressed sequence tags (ESTs) from a brain complementary DNA (cDNA) library and to identify the genes. A total of 1031 ESTs were sequenced, from which 73 contigs and 411 singletons were identified. BLAST homology analysis indicated that only 9.3% of these ESTs were homologues of known genes while the remaining 90.7% appeared to be novel sequences. Based on sequence similarities, 45 putative genes were identified that encodes stress proteins, enzymes and signal transduction regulators. Our study thus, provides a collection of novel transcripts and a partial annotation of genes that are expressed in brain tissue of the snow trout species, S. richardsonii.
Table: ESTs from cDNA of Schizothorax richardsonii

Description

Number

Total cDNAs Sequenced

1031

Total analysed cDNAs

1023

Average EST size (bp after trimming)

442

Total number of Unigenes

484

Number of Contigs

73

Number of orphan sequences (Singletons)

411

Unigenes with known gene match n(%)

45 (9.3%)

Unigenes with no match, n (%)

439 (90.7%)

  Neolissocheilus hexagonolepis
Species and Population Characterization of Coldwater Fishes Using Mitochondrial and Microsatellite Markers
1. Novel species identification - Schistura obliquofascia, a new loach from Uttarakhand, India
  • Amplicon of 307 bp of Cyt b region of the mtDNA was amplified using Universal Primers (Kocher et al. 1989).
  • L14841AAAAAGCTTCCATCCAACATCTCAGCATGATGAAA
  • H15149-AAACTGCAGCCC CTCAGAATGATATTTGTCCTCA
  • Sequences of the mitochondrial Cyt b genes of the other two species of Schistura and Schizothorax richardsonii were used for phylogeny.
  • Neighbor-joining tree and genetic distance data show S. corica to be genetically distant from the S. obliquofascia and S. beavani.
2. Species characterization using mitochondrial DNA (mtDNA)
Species were characterized using mtDNA (Cytb, ATPase 6/8, Cytochrome Oxidase I, Cytochrome Oxidase II and 16 SrRNA) markers.
  • Tor (T. putitora, T. tor, T. khudree T. chelynoides). N. hexagonolopis (Fig. A).
  • Four coldwater species (G. gotyla, B. bendelisis, S. richardsonii and T.putitora) (Fig. B)
  • Genus Schizothorax (S. richardsonii, S. esocinus, S. niger, S. progastus, S. plagiostomus) (Fig. C)
2. Species characterization using mitochondrial DNA (mtDNA)
Mitochondrial gene sequences and microsatellite markers were used to study the genetic differentiation and phylogenetic relationships between species and populations of coldwater fish species from different geographic regions of India.
Table: Population characterization of important coldwater fish species

Species

Type of Molecular marker

MtDNA  genes

Microsatellite

Tor putitora

 Cyt b (1140 bp) and ATPase6/8 (842 bp)

Cross species amplification through 13 microsatellite primer.

Schizothorax richardsonii

Cyt b (1140 bp) , ATPase6/8 (842 bp), COI (847 bp) and COII (560 bp)

28 developed
Microsatellite marker.

Barilius bendelisis

Cyt b (307 bp)

Cross species amplification through 13 microsatellite primer.

3. Genetic stock assessment of farm raised rainbow trout (Oncorhynchus mykiss) in India
  • The rainbow trout (Oncorhynchus mykiss) in India is a century old introduction, supporting trout farming in most of the cold water regions.
  • Genetic stock assessment of farmed rainbow trout from different coldwater regions of India was done for the first time.
  • Samples from Western Himalayas (Kashmir), Central Himalaya (Uttarakhand) and Southern India (Munnar hill) were evaluated for allelic and gene diversity using 15 polymorphic microsatellite loci.
  • This study revealed that RTMK (Munnar, Kerala) and RTDK (Dachigam, Kashmir) formed individual clusters while RTBU, RTCU (Bairangana and Champawat, Uttarakhand) and RTPH (Patlikul, Himachal Pradesh) stocks were grouped in another cluster indicating a common origin of the culture stocks.
  • Substantial genetic differentiation was observed among stocks, low inbreeding level and absence of bottleneck.
  • The study will provide the rationale for the management of farmed rainbow trout in India.
Functional Genomics
1. Bioprospecting of Genes And Allele Mining for Abiotic And Biotic Stress Tolerance 
Different types of abiotic and biotic stress have considerable effects on the physiological and metabolic activities of the fishes. In order to overcome such stresses, fish develop adaptive mechanisms for tolerance of adverse conditions. Studies were conducted to understand the effects of cold stress and possible mechanism of cold acclimation in Indian snow trout Schizothorax richardsonii.
• Physiology of cold acclimation in Schizothorax richardsonii and Barilius bendelisis
Glycerol accumulation in blood plasma and modulation in the activities of selected enzymes associated with glycerol synthesis in the liver under cold temperature were assessed in two freshwater cyprinid fishes, Schizothorax richardsonii (snow trout) and Barilius bendelisis (Indian hill trout). The decrease in temperature triggered higher accumulation of glycerol in the blood plasma of both the species. Glycerol accumulation in plasma was found to be associated with changes in enzyme in the liver. In both the species, liver exhibited higher activities of glycerol-3-phosphate dehydrogenase (GPDH) and higher concentration of dihydroxy acetone phosphate (DHAP) which gets converted into glycerol. Based on the enzyme profile studied, it was established that the freshwater cyprinids; S. richardsonii and B. bendelisis, a decrease in water temperature triggered the release of glycerol in the blood plasma and also activated metabolic response for glycerol accumulation. The higher accumulation of glycerol seems to contribute towards cold adaptation in these species.
• Expression profile of snow trout (Schizothorax richardsonii) GPDH gene in response to abiotic stress
Glycerol-3-phosphate dehydrogenase (GPDH) gene possibly plays a key role for cold acclimation process in snow trout during winter months when water temperature goes down to 4-5 0C. In S. richardsonii the qRT-PCR showed highest expression in muscle tissue followed by liver and also revealed 19 fold gene expression in liver tissue under cold (5 0C) in comparison with warm (15 0C) condition. The elevated expression levels of GPDH cDNA on cold treatment suggested that GPDH plays a role in stress related responses in S. richardsonii.
• Expression profile of snow trout (Schizothorax richardsonii) Mannose Binding Lectin gene in response to biotic stress
Teleost fishes mostly depend on their innate defense mechanisms, like LCP (Lectin Complement Pathway) to protect themselves from invading pathogens. Mannose binding lectin (MBL) is a member of the collectin family of proteins that plays an important role in the innate immune response. Its deficiency is often being associated with increased risk, severity and frequency of infections. The study was undertaken to identify and characterize MBL or its homologue in snow trout challenged with Aeromonas hydrophila (MTCC 646). Snow trout MBL homologue (Sch-GBL) was cloned and characterized for the first time in any Coldwater indigenous fish species in the high altitude Himalayas. The MBL homologue isolated in this study was found to be specific for galactose (Sch-GBL). Regulation of Sch-GBL by bacterial infection and downshift of temperature at transcription level was also studies. The present study also showed that Sch-GBL acts as an acute phase reactant after a bacterial infection (A. hydrophila).
Major Achievements (2015-16)
The mandate of ICAR-Directorate of Coldwater Fisheries Research is to expand and augment hill aquaculture production and manage coldwater fisheries resources in Indian uplands through comprehensive research initiatives, technological interventions and knowledge transfer. The accomplishments and various activities of the Directorate during the reporting period 2015-2016 are summarized as follows:
Resource assessment and management
  • Ichthyofaunal diversity, habitat status and hydrobiology of the rivers Western Ramganga and Kosi are being investigated. Preliminary analysis on quantitative pattern, richness and evenness of fish fauna indicated poor fish diversity in the sampled stretch of the river Western Ramganga.
  • Eco-biological study of selected mountain lakes in central and north-east Himalayan region have been initiated to understand the changing trophic dynamics of the targeted lacustrine ecosystem  such as high altitudinal lakes of Arunachal Pradesh and Sikkim
  • In order to develop a spatial database of coldwater resources in the Western Himalayan region, the natural water resources (rivers, lakes and reservoirs) of Jammu & Kashmir and Himachal Pradesh are being digitized using GIS.
  • The Directorate is associated in the National Mission for Sustaining the Himalayan Ecosystem with the responsibility to conduct research on sustainable development of coldwater fisheries and ecosystem monitoring in selected Himalayan regions.
  • The Directorate is also associated in the national network of germplasm centre for prioritized finfishes of Ganga basin (upland), with the objective to develop a germplasm repository of important endemic coldwater fishes at Bhimtal and Champawat.
Aquaculture oriented research and development
  • Potential indigenous fishes of food value have been targeted for complete domestication under the prioritized programme on species diversification for hill aquaculture. Captive breeding of Labeo pangusia has been achieved and Raiamas bola is targeted next.
  • Field trials on the prospect of including endemic fishes Bangana devdevi and Osteobrama belangeri in composite culture of Chinese carps suggested economic advantage.
  • Photo-thermal manipulation for gonadal maturity of golden mahseer in captivity is being experimentally attempted to overcome the exclusive dependence on wild collected female brooders for seed production. Photoperiod induced changes in the profile of reproductive hormones have been recorded and aromatase encoding genes were partially characterized.
  • Full length cDNA of kisspeptin1, kisspeptin1 receptor and kisspeptin2 of golden mahseer were cloned and characterized. Further, the structural analysis of the predicted kiss1 and kiss1r peptides has been carried out to support in vivo physiological studies later.
  • A broad ranging project has been taken up to decipher the physiological mechanisms underlying nutrient mediated regulation of growth and maturation in Schizothorax richardsonii. Wild collected snow trout have been successfully acclimatized and reared in captivity. The effect of nutritional status on growth physiology is being experimentally elucidated. Concurrently, captive breeding of farm raised brooders have been achieved.
  • The biochemical composition, fatty acid profile, cholesterol, triglyceride and mineral concentration of six different snow trout species have been determined to accentuate its nutritional value as a dietary component for human consumption.
  • Under feed outreach activity, two cost-effective rainbow trout starter feed formulations were developed and experimentally found to outperform existing commercial feeds.
  • Breeding and seed production of important coldwater fishes such as rainbow trout (2.34 lakh eyed ova), improved Hungarian common carp (1.3 lakh fry), golden mahseer (45,000 fingerlings), minor carps (3 lakh fry) and ornamental fishes was successfully carried out. The revenue generated from the sale of rainbow trout, common carp and golden mahseer seed amounted to 2.26 lakh rupees.
Fish health management
  • Potential bacterial pathogens present in the rainbow trout farms of Sikkim and Himachal Pradesh were profiled and maintained in the laboratory. The overall observations suggest the prevalence of secondary bacterial pathogens.
  • Under the National Surveillance Programme on Aquatic Animal Diseases, 25 rainbow trout and carp farms of Himachal Pradesh, Jammu & Kashmir and Uttarakhand were surveyed for the presence of coldwater fish diseases. The results indicated the absence of infectious pancreatic necrosis virus and viral haemorrhagic septicemia virus.
  • Under the All India Network Project on fish health, primary data concerning the use of aqua drugs, medicines, antibiotics and treatment kits were collected from nearly 300 fish farms in six hill states. Table salt, lime and potassium permanganate were the commonly used agents for fish health management in hill aquaculture practices.
  • Mx gene and Mx promoter of snow trout have been identified and characterized at the molecular level in the first phase of an approach that aims to develop a method for detecting the presence of virus signal in clinical samples of fish.
  • 10 bacterial isolates were identified and characterized based on their growth inhibiting and algicidal activities, in order to develop a bacterial bioremediation measure that can mitigate Microcystis aeruginosa blooms in aquaculture ponds and water bodies.
Molecular genetics and biotechnological contribution
  • Under the institute project “Bioprospecting of genes and allele mining for thermal stress tolerance of Schizothorax richardsonii” novel thermal tolerance responsive transcripts in snow troutwere identified. 20,506 unigenes were annotated using Blast2Go into 35 functional groups with 107,353 terms.
  • Under Fish Genetic Stock –Outreach project Chocolate mahseer and brown trout were collected from different geographically isolated populations for genetic characterization. Genomic DNA was isolated from fin tissue. Mitochondrial genes i.e. were used to
  • Characterized different populations of chocolate mahseer and brown trout using cytochrome oxidase (CO-I), ATP synthase-6/ATP synthase-8 gene (ATPase6/8) and cytochrome b (Cyt-b).
  • A partial genomic library was constructed for isolation of SSR markers using genomic DNA of chocolate mahseer and brown trout.
  • The microsatellite loci were identified using perl script MISA. About 19,786 loci were identified in brown trout and 1, 84, 882 in chocolate mahseer. Initially, 56 SSR markers were isolated for PCR genotyping in brown trout and 32 SSR markers for Chocolate mahseer populations.
  • Partial complementary DNA sequences encoding elongation factor 1α, β-Actin and aromatase genes cyp19a/b in Schizothorax richardsonii (KU715836, KU715835, KU715837 and KU715838) and Tor putitora (KU714645, KU714644, KU714647 and KU714646) were PCR amplified, cloned, sequenced and submitted to NCBI GenBank.
C. Extension activities and training programmes
Initiatives under tribal sub-plan
  • For promotion of rainbow trout farming in remote tribal areas of Pithoragarh district, Uttarakhand, four new raceways were constructed for four tribal beneficiaries. Besides, trout fingerlings were distributed and stocked in two of those raceways.
  • Training on ‘Fish processing and value addition’, ‘Carp grow-out technology’ and ‘Fish health and water quality management’ was imparted to tribal farmers and women of Uttarakhand, to ensure nutritional and livelihood support.
  • Front line demonstrations on fish farm management were provided to selected tribal farmers of Uttarakhand and fish seed, feed and fishing gears were distributed to the adopted farmers.
Initiatives under NEH plan
  • A National workshop on "Coldwater Endemic Fishes of North East: Avenues and challenges" was organized in Gangtok, Sikkim during November 5-6, 2015. Action plan for development of culture and breeding protocols and captive management of important endemic fish species like Semiplotus semiplotus, Neolissocheilus hexagonolepis, Osteobrama belangiri, Labeo pangusia, Schistura spp. Botis spp etc. was recommended.
  • Technical support was provided for the creation of trout ova house at Nuranang and trout hatchery facilities at Shergaon , Arunachal Pradesh for expansion of rainbow trout farming. Similar technical support was also provided for developing two Chocolate mahseer hatcheries at Tura, West Garo Hills, Meghalaya and Thimlak Fish Farm, Tuensang district, Nagaland.
  • Culture practice of endemic minor carps such as Bangana devdevi with exotic carps was introduced and field trial is being carried out in 10 farms in Manipur. Likewise, artificial breeding of minor carp, Labeo pangusia is being done at Nameri Eco-park, Assam.
  • Complete technical support was provided to the Directorate of Fisheries, Sikkim in broodstock development/maintenance, breeding and seed production of rainbow trout.
Extension activities
  • Three training programmes sponsored by National Fisheries Development Board were conducted for state fisheries department officials and farmers at Mawpun, Meghalaya, Chatlang, Mizoram and Chug village (Dirang), Arunachal Pradesh.
  • Farm-specific advisory were given to trout farmers including appropriate stocking density, water flow, grading, raceway maintenance and feed management. A demonstration on trout breeding and seed production for fish farmers and interested public was conducted on the occasion of ‘Jai Kisan Jai Vigyan’ week at Champawat. Several other training and awareness programmes on various aspects of fish farm management were also organized.
  • During the year, thirteen exhibitions of ICAR-DCFR R & D activities were displayed during Kisan mela, National and International Conferences.
  • In continuation of the painstaking endeavor towards stock enhancement of golden mahseer in its native habitats, 30,000 seed were ranched in the mahseer sanctuary near Baijnath temple and 9000 seed in Bhimtal lake, Uttarakhand.
Notice Board
International Yoga Day
International Yoga Day Celebration at DCFR Bhimtal & Champawat
 
World Environment Day
Mahseer Seed Ranching in Teesta River of Sikkim on World Environment Day (5th June, 2017)
 
World Environment Day
World Environment Day celebration at ICAR-DCFR, Bhimtal
 
Namami Gange Programme
Ranching of Mahseer Fingerlings in Ganga River at Laksmanjhula, Rishikesh under Namami Gange Programme
 
Swachh Bharat Pakhwada
Swachh Bharat Pakhwada at ICAR-DCFR, Bhimtal from 16 to 31.5.2017
 
Rishi Unnati Mela 2017
Salient Attractions of Krishi Unnati Mela 2017
 
Minister Visit
Shri S.S. Ahluwalia, Hon’ble Minister of State for Agriculture and Farmers Welfare visited ICAR-DCFR, Bhimtal on 2.3.2017
 
National Productivity Week
National Productivity week celebration on 12-18 February, 2017
 
Swachh Bharat Abhiyan
Swachh Bharat Abhiyan, Progress Report for the month of January, 2017
 
Agriculture Education Day
ICAR-DCFR Bhimtal and DCFR, Field Centre, Champawat organized Agriculture Education Day on 3rd December, 2016
 
World Soil Day
ICAR-DCFR Field Centre, Champawat organized World Soil Day at vill-Katharh on 05.12.2016
 
Rehabilitation programme
Rehabilitation programme at Pancheshwar by ranching fish seed of mahseer and snow trout
 
सतर्कता जागरूकता सप्ताह Report
ICAR-DCFR, observing Vigilance week during 31 October to 5 November
 
2nd October, 2016
Swachh Bharat Pakhwada at Field Centre Champawat
 
Obituary
Obituary
 
Swachh Bharat Mission
ICAR-DCFR Observes Swachhta Pakhwara under Swachh Bharat Mission- 16-31 October, 2016
 
Awareness-cum-training programme
ICAR-DCFR organized awareness-cum-training programme on trout farming in highlands on 2nd October, 2016
 
Swachhta Pakhwara Report
ICAR-DCFR Observes Swachhta Pakhwara under Swachh Bharat Mission- 2-16 Oct, 2016
 
National Interactive Meet
ICAR-DCFR, Bhimtal Convened National Interactive Meet at Jasingfaa Eco-tourism Centre, Nagaon, Assam
 
29th Foundation Day
ICAR-DCFR, Bhimtal Celebrated 29th Foundation Day
 
Interactive Meet
Interactive Meet on Mahseer in Recreational Fisheries & Eco-tourism in Northeast India
 
Awards
DCFR Nominated Farmer received the IARI-Innovative Farmers Award 2016
 
Training Programme
NFDB Sponsored Training Organized at Farm School, Toli, Champawat
 
Training Programme
ICAR-DCFR , Bhimtal organized Training Cum Demonstration Programme at Ziro Valley of Arunachal Pradesh
 
Training Programme
ICAR-DCFR and ICAR- CIFT organized Training on Fish processing and Value addition for tribal woman
 
Awareness Programme
ICAR-DCFR Field Centre, Champawat organized one day Awareness Programme on fish health management under National Surveillance programme for Aquatic Animal Diseases
 
Dissemination Programme
ICAR-DCFR Field Centre, Champawat Organized Demonstration Program on Breeding and Seed Production of Rainbow trout
 
Training Programme
ICAR-DCFR organized NFDB sponsored training & input distribution programme under NEH activity covering soil & water testing for aquaculture
 
National Workshop
National Workshop on Coldwater Endemic Fishes of North Eastern Himalaya: Avenues & Challenges on 5-6 November, 2015
 
Rainbow Trout Farming
National Consultation on “Rainbow Trout Farming: Prospects and Challenges for Strategic Development”, 20-21 September, 2015
 
Labeo Pungusia Report
Captive breeding of Labeo Pungusia, an endemic hill stream fish of North East India in PPP mode
 
Fish Farmers day
Fish Farmers day celebration at ICAR-DCFR Field Centre, Champawat
 
Workshop
ICAR-DCFR organized a workshop of Task Force on Himalayan Agriculture under the National Mission on Sustaining Himalayan Ecosystems on June 4-5, 2015
 
Training Programme
ICAR-DCFR arranged Training on Fish processing and Value addition for tribal woman
 
Intellectual Property Rights Day
Intellectual Property Rights Day celebration on 28 April, 2015
 
Training Programme
Training Programme for Fish farmers on Fish Disease Management & Control during 30 March, 2015
 
Training Programme
ICAR-DCFR Bhimtal organized NFDB sponsored Training Programme for farmers on Common Fish diseases in mid-hill fish tanks and their control during 18-22 March, 2015
 
Training Programme
ICAR-DCFR Bhimtal organized NFDB sponsored Training Programme on Prevention & Control of Diseases in Rainbow Trout during 10-14 March, 2015
 
Training Programme
ICAR-DCFR organized a Training Programme for State fishery officials at Kalimpong GTA, West Bengal and Itanagar, Arunachal Pradesh
 
Training Programme
ICAR-DCFR organized a Training Programme for farmers on "Coldwater Fish Farm Management in Mid Hills" held during 27th-31st January, 2015at Field Centre Champawat
 
Training Programme
A Training Programme on CULTURE AND BREEDING OF IMPORTANT COLDWATER FISH SPECIES
 
Training Programme
A Training Programme on MANAGEMENT PRACTICES OF JHORA FISHERIES
 
Swachh Bharat Mission
Swachh Bharat Mission
 
National Workshop
ICAR-DCFR organized National Workshop on Mahseer in India: Resources, Captive Breeding, Propagation, Policies & Issues at Guwahati
 
National Workshop
National Workshop on Mahseer in India: Resources, Captive Breeding, Propagation, Policies & Issues
 
NFDB Sponsored Training Programme
NFDB Sponsored Training Programme on Hatchery management and seed production practices of golden mahseer Organized at ICAR-DCFR
 
Swachh Bharat
DCFR follows Swachh Bharat mass movement of Honble Prime Ministers call
 
27th Foundation Day Celebration
27th Foundation Day Celebration at Directorate of Coldwater Fisheries Research on 24.9.2014
 
DCFR cage raised mahseer fingerlings
DCFR cage raised mahseer fingerlings reached Nongmahir Lake, Meghalaya for stock enhancement
 
Farmers Meet Organized on ICAR, Foundation Day
Farmers Meet Organized on ICAR, Foundation Day on 16th July 2014
 
Workshop on Intellectual Property Management
Workshop on Intellectual Property Management in Fisheries and Agriculture Sectors on July 19, 2014.
 
Fish Farmers Day
DCFR Organized Fish Farmers Day at Tribal Village Belkheda in Uttarakhand
 
Vigyan Ratn
Vigyan Ratn award was conferred to Dr. A.K. Singh, Director DCFR by the Council of Science and Technology, Government of Uttar Pradesh.
 
ICAR Sponsored Short Course
ICAR Sponsored Short Course on Application of Molecular Tools in Coldwater Fisheries Management
 
Report of Seed Ranching
Report of Seed Ranching Programme at Naukuchiatal Lake
 
Abstract book
Abstract book of National Workshop entitled "Parvatiye Chetron main Jaljeev Palan Vividhikaran
 
23-24 September, 2013
Report of Two Days National Workshop entitled "Parvatiye Chetron main Jaljeev Palan Vividhikaran" in Hindi
 
23-24 September, 2013
Two Days National Workshop entitled "Parvatiye Chetron main Jaljeev Palan Vividhikaran" in Hindi organized by DCFR, Bhimtal
 
10th July 2013
Directorate of Coldwater Fisheries Research, Bhimtal Celebrated Fish Farmers Day at village Tharu Teeshora in US Nagar, Uttarakhand
 
1 to 6 July, 2013
Upcoming Hands on Training Program on Molecular Techniques for Fish Biodiversity Analysis
 
29 March 2013
Visit of Hon’ble Minister of State for Agriculture and Food Processing Industries, Shri Tariq Anwar Ji at Directorate of Coldwater Fisheries Research, Bhimtal, Uttarakhand on 29 March 2013
Visit of Hon’ble Minister of State for Agriculture and Food Processing Industries, Shri Tariq Anwar Ji at Directorate of Coldwater Fisheries Research, Bhimtal, Uttarakhand on 29 March 2013
 
Website Inauguration
Inauguration of Official Website of DCFR, Bhimtal on 29.03.2013
Inauguration of Official Website of DCFR, Bhimtal on 29.03.2013
 
A new loach identified from Uttarakhand
A new loach identified from Uttarakhand
A new loach identified from Uttarakhand
 
Tender Notice
22nd June 2017
Inviting tender for selling of condemned vehicle
 
9th June 2017
Quotation for Fluorimeter
 
18th May 2017
Quotation for Thermal Cycler
 
5th May 2017
Annual Rate Contract for Manpower services at DCFR, Bhimtal & Field Centre Champawat
 
5th May 2017
Annual Rate Contract for Watch & Ward services at DCFR, Bhimtal & Field Centre Champawat
 
8th May 2017
Rate Contract for DNA Sequencing & other Custom Services
 
5th April 2017
Annual Rate Contract for Hiring of vehicles from transport agencies
 
22nd March 2017
Quotation for purchasing of Photocopier Machine
 
Recruitment
Walk in Interview
Result of Walk in Interview held on 29.5.2017
 
Walk in Interview
Walk in Interview will be held on 29th May 2017 for different posts on contractual basis
 
Home | Help | Copyright Policy | Content | Contact Us | Website Team | Privacy | Terms & Conditions
Directorate of Coldwater Fisheries Research, Anusandhan Bhawan, Industrial Area, Bhimtal - 263136, INDIA, Phone No. - Director: 91-5942-247280 (O)
FAX: 91-5942-247693 E-Mail: director@dcfr.res.in/ dcfrin@rediffmail.com/ dcfrin@gmail.com
All rights reserved. | updated on : 22-06-2017 : 05:00 PM
Best viewed at 1024 X 768 Resolutions | Internet Explorer 6.0 - Later Version